Home|Journals|Articles by Year Follow on Twitter

Directory for Medical Articles
 

Open Access

Review Article

SRP. 2020; 11(3): 583-586


Characterization of Lactic Acid Bacteria and Determination of Antimicrobial Activity in Dadih from Air Dingin Alahan Panjang District, Solok Regency-West Sumatera

Harnavi Harun, Yan Wirasti, Bambang Purwanto, Endang Purwati.

Abstract
Traditional Indonesian fermented foods have been studied as potential probiotics, for example dadiah from West Sumatera are made by fermenting buffalo milk in bamboo tubes. But the potential of halal probiotics isolated from Air Dingin District, West Sumatra (Indonesia) has not been studied. The purpose of this study was to determine the potential of halal probiotic lactic acid bacteria (LAB) Lactobacillus plantarum strain 8m-21 isolation from dadiah in Air Dingin Alahan Panjang District, Solok Regency West Sumatera (Indonesia) against to pathogenic bacteria and antimicrobial activity. Previously lactic acid bacteria Lactobacillus plantarum had been isolationand molecular identification used I6S rRNA with Forward (27F AGAGTTTGATCCTGGCTGAG) and Reverse primer (1492R; GTTTACCTTACGACTT). In this study we analyzed the probiotics have antimicrobial activity against pathogenic bacteria Escherichia coli O157. The results showed that Lactobacillus plantarum strain 8m-21 from Air Dingin dadiah isolates have probiotic properties because they have antimicrobial properties which able to inhibit Escherichia coli, aerob (pathogenic) bacteria and have highest antimicrobial with 20.25 mm inhibition than other sintetic antibiotics.

Key words: Antimicrobial, Dadiah, Probiotic, and Lactobacillus plantarum



Similar Articles

Passive social media use and psychological well-being during the COVID-19 pandemic: The role of social comparison and emotion regulation.
Yue Z, Zhang R, Xiao J
Computers in human behavior. 2022; 127(): 107050

Biovalue in Human Brain Banking: Applications and Challenges for Research in Neurodegenerative Diseases.
Vedam-Mai V
Methods in molecular biology (Clifton, N.J.). 2022; 2389(): 209-220

Using the Health Belief Model to examine travelers' willingness to vaccinate and support for vaccination requirements prior to travel.
Suess C, Maddock J, Dogru T, Mody M, Lee S
Tourism management. 2022; 88(): 104405

Occupant health in buildings: Impact of the COVID-19 pandemic on the opinions of building professionals and implications on research.
Awada M, Becerik-Gerber B, White E, Hoque S, O'Neill Z, Pedrielli G, Wen J, Wu T
Building and environment. 2022; 207(): 108440

Exploring the Alzheimer's disease neuroepigenome: recent advances and future trends.
Zhang H, Elefant F
Neural regeneration research. 2022; 17(2): 325-327


Full-text options


Latest Statistics about COVID-19
• pubstat.org


Add your Article(s) to Indexes
• citeindex.org






Covid-19 Trends and Statistics
ScopeMed.com
CiteIndex.org
CancerLine
FoodsLine
PhytoMedline
Follow ScopeMed on Twitter
Author Tools
eJPort Journal Hosting
About BiblioMed
License Information
Terms & Conditions
Privacy Policy
Contact Us

The articles in Bibliomed are open access articles licensed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License (https://creativecommons.org/licenses/by-nc-sa/4.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.
ScopeMed is a Database Service for Scientific Publications. Copyright ScopeMed Information Services.



ScopeMed Web Sites