Home|Journals|Articles by Year Follow on Twitter

Directory for Medical Articles
 

Open Access

Original Research



Association of IGF1 Gene Polymorphism with Growth Rates in Madras Red Sheep

Chitra Ramasamy.

Abstract
Insulin-like growth factors (IGFs), formerly called somatomedin, are members of a family of insulin related peptides. Insulin-like growth factors 1 (IGF-1) plays a key role in mammalian growth, lactation and metabolism, by stimulating anabolic processes such as cell proliferation, skeleton and hair growth and protein synthesis. The aim of this study was to investigate the association of IGF1 (exon1) gene polymorphism with growth rates in Madras Red sheep. Blood samples were collected from 66 animals maintained at Post Graduate Research Institute in Animal Sciences, Kattupakkam and 70 animals from farmers’ flock in the breeding tract of Madras Red sheep and DNA was isolated using high salt method. The animals were genotyped by Polymerase Chain Reaction – Single Strand Conformation Polymorphism (PCR-SSCP). In the PCR reaction the primers used were 5’ ATTACAGCTGCCTGCCCCTT 3’ and 5’ CACATCTGCTTACACCTTACCCG 3’. A 265 bp long IGF1 (exon1) gene PCR product was genotyped for polymorphic pattern using SSCP method. The PCR-SSCP analysis of exon1 IGF-I revealed three distinct patterns viz., AA, AG and GG and the genotype frequencies were in the order of 0.963, 0.022 and 0.015. In the present study, no significant effect (P>0.05) was observed between genotypes on all age groups in Madras Red sheep.

Key words: Genetic polymorphism, PCR-SSCP, IGF1 gene, Exon 1, Madras Red sheep



Similar Articles

Biovalue in Human Brain Banking: Applications and Challenges for Research in Neurodegenerative Diseases.
Vedam-Mai V
Methods in molecular biology (Clifton, N.J.). 2022; 2389(): 209-220

Identification of key genes involved in axon regeneration and Wallerian degeneration by weighted gene co-expression network analysis.
Lu Y, Shan Q, Ling M, Ni XA, Mao SS, Yu B, Cao QQ
Neural regeneration research. 2022; 17(4): 911-919

Cerebral dopamine neurotrophic factor transfection in dopamine neurons using neurotensin-polyplex nanoparticles reverses 6-hydroxydopamine-induced nigrostriatal neurodegeneration.
Fernandez-Parrilla MA, Reyes-Corona D, Flores-Martinez YM, Nadella R, Bannon MJ, Escobedo L, Maldonado-Berny M, Santoyo-Salazar J, Soto-Rojas LO, Luna-Herrera C, Ayala-Davila J, Gonzalez-Barrios JA, Flores G, Gutierrez-Castillo ME, Espadas-Alvarez AJ, Martínez-Dávila IA, Nava P, Martinez-Fong D
Neural regeneration research. 2022; 17(4): 854-866

Non-invasive gene delivery across the blood-brain barrier: present and future perspectives.
Kimura S, Harashima H
Neural regeneration research. 2022; 17(4): 785-787

Clinical Utility of Methylation-Specific Multiplex Ligation-Dependent Probe Amplification for the Diagnosis of Prader-Willi Syndrome and Angelman Syndrome.
Kim B, Park Y, Cho SI, Kim MJ, Chae JH, Kim JY, Seong MW, Park SS
Annals of laboratory medicine. 2022; 42(1): 79-88


Full-text options


Latest Statistics about COVID-19
• pubstat.org


Add your Article(s) to Indexes
• citeindex.org






Covid-19 Trends and Statistics
ScopeMed.com
CiteIndex.org
CancerLine
FoodsLine
PhytoMedline
Follow ScopeMed on Twitter
Author Tools
eJPort Journal Hosting
About BiblioMed
License Information
Terms & Conditions
Privacy Policy
Contact Us

The articles in Bibliomed are open access articles licensed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 International License (https://creativecommons.org/licenses/by-nc-sa/4.0/) which permits unrestricted, non-commercial use, distribution and reproduction in any medium, provided the work is properly cited.
ScopeMed is a Database Service for Scientific Publications. Copyright © ScopeMed® Information Services.



ScopeMed Web Sites