Abstract

Background:
Although the systematic relationships between species of several mugilid genera have been better understood thanks to recent research on the molecular phylogeny of the family Mugilidae, there is still a lack of clarity regarding the taxonomic status and evolutionary relationships among certain closely related species.

Aim:
To assess the evolutionary connections of some species of the family Mugilidae, this study used the small mitochondrial rRNA (12S rRNA) gene.

Methods:
Four species (Chelon labrosus, Chelon aurata, Chelon ramada, and Mugil cephalus) were gathered at Port Said city on the Mediterranean Sea. The 12S rRNA gene was amplified in the four species using primers (Marinefsh-12SrRNA-F: ACTAAAGCATAACACTGAAGAT and Marinefsh-12SrRNA-R: TTCATTTCTCTTTCAGCTTTCC).

Results:
The nucleotides of small mitochondrial rRNA sequences were added to GenBank and assigned accession numbers PZ236375.1–PZ236378.1. The length of the small mitochondrial rRNA sequences differed among the samples from 650 bps to 679 bps; Mugil cephalus had 679 bps, whereas Chelon labrosus and Chelon auratus had 650 bps. The A+T combination of 12S rRNA is higher than its C+G ratio.

Conclusion:
The findings of this study highlight the usefulness of small mitochondrial 12S rRNA for the phylogenetic analysis of species in the Mugilidae family.

Key words: Chelon labrosus; Mugil cephalus; Small mitochondrial rRNA.